View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5558_low_27 (Length: 229)
Name: NF5558_low_27
Description: NF5558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5558_low_27 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 38524765 - 38524540
Alignment:
| Q |
1 |
gaaagtcgaaagtgaaccacacacactttctctgtttatcactaaactgt-ggattaacccaacgacaggagaaactgccggataaattaaggcaggaag |
99 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |||||||| || ||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38524765 |
gaaagtcgaaaatgaaccacacacactttctctgtttaccactaaaccgttggattaatccaacgacaagagaaactgccggataaattaaggcaggaag |
38524666 |
T |
 |
| Q |
100 |
ggattcatttcgtattaaaatagtacctgtttgttccaacaacnnnnnnnnngtacccggacatcttactttgcgttgcttcccaaaaattaattcttga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38524665 |
ggattcatttcgtattaaaatagtacctgtttgttccaacaa----aaaaaagtacccggacatcttactttgcgttgcttcccaaaaattaattcttga |
38524570 |
T |
 |
| Q |
200 |
cccaaatagtaaacaaatattgcagtgttt |
229 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
38524569 |
cccaaatagtaaacaaataatgcagtgttt |
38524540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University