View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5559-Insertion-3 (Length: 340)
Name: NF5559-Insertion-3
Description: NF5559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5559-Insertion-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 8 - 335
Target Start/End: Complemental strand, 4564957 - 4564623
Alignment:
| Q |
8 |
atttgatcatgtgcatttgatcctgcagctttaaaccgaatatctctctatctatatccactt-------tttcttatttaattttcttttctattgggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
4564957 |
atttgatcatgtgcatttgatcctgcagctttaaaccgaatatctctctatctatatccacttgggtaattttcttattcaattttcttttctattgggt |
4564858 |
T |
|
| Q |
101 |
aatgagtatacaaatccacttctccacctgtttaagttttttccctctgacaaaatccacatgctaaagaagagaggttgaagcaacaggacccacccca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4564857 |
aatgagtatacaaatccacttctccacctgtttaagttttttccctctgacaaaatccacatgctaaagaagagaggttgaagcaacaggacccacccca |
4564758 |
T |
|
| Q |
201 |
cgttcacatggaagtggtaggaaggaaatgaccatatatgacccacacattcacatacacaactttcacttaaccttctttctcttgtttctttattaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4564757 |
cgttcacatggaagtggtaggaaggaaatgaccatatatgacccacacattcacatacacaactttcacttaaccttctttctcttgtttctttattaag |
4564658 |
T |
|
| Q |
301 |
gaatttgattcttttaacccttcctagatctctct |
335 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |
|
|
| T |
4564657 |
gaatttgattcttttaacccttcctatatctctct |
4564623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University