View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5560-Insertion-6 (Length: 240)

Name: NF5560-Insertion-6
Description: NF5560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5560-Insertion-6
NF5560-Insertion-6
[»] chr4 (1 HSPs)
chr4 (8-240)||(52051973-52052205)
[»] chr2 (1 HSPs)
chr2 (126-240)||(18199789-18199903)
[»] chr8 (1 HSPs)
chr8 (138-240)||(7246548-7246650)
[»] chr7 (1 HSPs)
chr7 (138-195)||(42091957-42092014)


Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 240
Target Start/End: Complemental strand, 52052205 - 52051973
Alignment:
8 ggtaattagtgtcatgggttgttgatgttagtgctgcagtgttatgatcagaatcaagactactatttttggtaattgataagattgttgaagtagcagc 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
52052205 ggtaattagtgtcatgggttgttgatgttagtgctgcagtgttatgatcagaatcaagactactatttttagtaattgataagattgttgaagtagcagc 52052106  T
108 aggagcatctgtgtttgttgttttcaaaacttccacaggctttcttgaacggtttttccctctatgcatgtgcctttcacagtactttgtatctggatat 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
52052105 aggagcatctgtgtttgttgttttcaaaacttccacaggctttcttgaacggtttttccctctatgcatgtgcctttcacagtactttgaatctggatat 52052006  T
208 gcttcttttgaacatctccatttctttccatct 240  Q
    |||||||||||||||||||||||||||||||||    
52052005 gcttcttttgaacatctccatttctttccatct 52051973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 126 - 240
Target Start/End: Original strand, 18199789 - 18199903
Alignment:
126 tgttttcaaaacttccacaggctttcttgaacggtttttccctctatgcatgtgcctttcacagtactttgtatctggatatgcttcttttgaacatctc 225  Q
    |||||| | |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| || | ||||||||||||||||||||| ||||||    
18199789 tgttttaacaacttccacaggctttcttgaacggttttttcctctatgcatgtgtctttcacagtatttagaatctggatatgcttcttttgagcatctc 18199888  T
226 catttctttccatct 240  Q
    ||||| |||||||||    
18199889 catttttttccatct 18199903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 138 - 240
Target Start/End: Original strand, 7246548 - 7246650
Alignment:
138 ttccacaggctttcttgaacggtttttccctctatgcatgtgcctttcacagtactttgtatctggatatgcttcttttgaacatctccatttctttcca 237  Q
    ||||||||||||||||||||||||| | ||||| |||||||| ||||||||||||||||  |||||||||||||| ||||| |||||||||||||| |||    
7246548 ttccacaggctttcttgaacggtttctacctctgtgcatgtgtctttcacagtactttgagtctggatatgcttcctttgagcatctccatttcttgcca 7246647  T
238 tct 240  Q
    |||    
7246648 tct 7246650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 138 - 195
Target Start/End: Complemental strand, 42092014 - 42091957
Alignment:
138 ttccacaggctttcttgaacggtttttccctctatgcatgtgcctttcacagtacttt 195  Q
    ||||||||||||||||||||||||| | || | ||||||||| |||||||||||||||    
42092014 ttccacaggctttcttgaacggtttctaccacgatgcatgtgtctttcacagtacttt 42091957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University