View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5560_low_7 (Length: 259)
Name: NF5560_low_7
Description: NF5560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5560_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 126 - 243
Target Start/End: Original strand, 48956944 - 48957061
Alignment:
| Q |
126 |
gctactcaccgggccacacgttaacagtagtaaactaaccctctcctttcattcattttggctacttctacattgaattcagctatctaccatatgattc |
225 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48956944 |
gctactcaccgtgccacacgttaacagtagtaaactaaccctctcctttcattcattttggctacttctgcattgaattcagctatctaccatatgattc |
48957043 |
T |
 |
| Q |
226 |
catccttgttgttggttt |
243 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
48957044 |
catccttgttgttggttt |
48957061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 48956809 - 48956904
Alignment:
| Q |
1 |
aaaactcaaaagtaactaaccctctcatttccaaaacaacatggggactatgttgtttattgccgttgataaacatgaggtggttaatttcatcgc |
96 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48956809 |
aaaattcaaaagtaactaaccctctcatttccaaaacaacatggggacgatgttgtttattgccgttgataaacatgaggtggttaatttcatcgc |
48956904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University