View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5561-Insertion-11 (Length: 375)
Name: NF5561-Insertion-11
Description: NF5561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5561-Insertion-11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 8 - 353
Target Start/End: Original strand, 42358734 - 42359088
Alignment:
| Q |
8 |
gctgtttactagaaacaatgctgggaagtttgcagaagagcacgcaatctctgaggatggagttgaaatgacctttgccactaattatttaggtgagtaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358734 |
gctgtttactagaaacaatgctgggaagtttgcagaagagcacgcaatctctgaggatggagttgaaatgacctttgccactaattatttaggtgagtaa |
42358833 |
T |
|
| Q |
108 |
gattacaacaaannnnnnn------atttgatatgcatataatttaat-taattaat--atattgtggtgcaggtcattttgtgttgacaaaaatgttga |
198 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358834 |
gattacaacaatttttatttttttaatttgatatgcatataatataatataattaattaatattgtggtgcaggtcattttgtgttgacaaaaatgttga |
42358933 |
T |
|
| Q |
199 |
tgaagaagatggttgaaacggcaaaggagacagggatagaaggaaggatagtgaacgtgtcgtccgcaatacacggttggtttactggcgacgtcatctc |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358934 |
tgaagaagatggttgaaacggcaaaggagacagggattgaaggaaggatagtgaacgtgtcgtccgcaatacacggttggtttactggcgacgtcatctc |
42359033 |
T |
|
| Q |
299 |
ctatttggctcatatatgccgcaacaaaaggtgacaaataactactattatctta |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42359034 |
ctatttggctcatatatgccgcaacaaaaggtgacaaataactactattatctta |
42359088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University