View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5561_high_14 (Length: 237)
Name: NF5561_high_14
Description: NF5561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5561_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 17 - 184
Target Start/End: Original strand, 38932984 - 38933151
Alignment:
| Q |
17 |
agtaattacatgcattaatcaatctcagtgttctatttaggatccgttagctcatattacaatttccactaaatttagaccattaataatcttcactatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38932984 |
agtaattacatgcattaatcaatctcagtgttctatttaagatccgttagctcatattacaatttccactaaatttagaccattaataatcttcactatt |
38933083 |
T |
 |
| Q |
117 |
aatttgagttgttacctgaaatctaaattcaaacaatagaagtatgtctcttttttcaaagaaagact |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38933084 |
aatttgagttgttacctgaaatctaaattcaaacaatagaagtatgtctcttttttcaaagaaagact |
38933151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 192 - 222
Target Start/End: Original strand, 38933167 - 38933197
Alignment:
| Q |
192 |
ttgctgagttgttacctgaacaagccctttg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
38933167 |
ttgctgagttgttacctgaacaagccctttg |
38933197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University