View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5561_low_16 (Length: 237)
Name: NF5561_low_16
Description: NF5561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5561_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 1673890 - 1673672
Alignment:
| Q |
1 |
tgcattatgtattcagatggatatgaatatggaaaatgaagacggtgagcaaagatgacaagataaggccaactcaacacaacatggatttggaatgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1673890 |
tgcattatgtattcagatggatatgaatatggaaaatgaagacggtgagcaaagatgacaagataaggccaactcaacacaacatggatttggaatgcaa |
1673791 |
T |
 |
| Q |
101 |
tgtttgcggattgtctattcatgaagcggttacatgatgcatcttcttctatgttcca-nnnnnnnattaattaagtaaatacaaaacgtataaaaacaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1673790 |
tgtttgcggattgtctattcatgaagcggttacatgatgcatcttcttctatgttccattttttttattaattaagtaaatacaaaacgtataaaaacaa |
1673691 |
T |
 |
| Q |
200 |
aaacaagaataacatggac |
218 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1673690 |
aaacaagaataacatggac |
1673672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University