View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5562-Insertion-5 (Length: 70)
Name: NF5562-Insertion-5
Description: NF5562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5562-Insertion-5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 2e-26; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 2e-26
Query Start/End: Original strand, 8 - 67
Target Start/End: Original strand, 1718882 - 1718941
Alignment:
| Q |
8 |
aattgtcatatgaaaaactgatggatcattgtcatcccaatttgtgccttgataatctgc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1718882 |
aattgtcatatgaaaaactgatggatcattgtcatcccaatttgtgccttgataatctgc |
1718941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 4e-25
Query Start/End: Original strand, 10 - 67
Target Start/End: Original strand, 1740222 - 1740279
Alignment:
| Q |
10 |
ttgtcatatgaaaaactgatggatcattgtcatcccaatttgtgccttgataatctgc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1740222 |
ttgtcatatgaaaaactgatggatcattgtcatcccaatttgtgccttgataatctgc |
1740279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 8 - 63
Target Start/End: Original strand, 1750607 - 1750662
Alignment:
| Q |
8 |
aattgtcatatgaaaaactgatggatcattgtcatcccaatttgtgccttgataat |
63 |
Q |
| |
|
||||||||| | ||| |||||||| ||| | || |||||||||||||||||||||| |
|
|
| T |
1750607 |
aattgtcattttaaagactgatgggtcactttcttcccaatttgtgccttgataat |
1750662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University