View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5564-Insertion-3 (Length: 285)
Name: NF5564-Insertion-3
Description: NF5564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5564-Insertion-3 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 7 - 285
Target Start/End: Complemental strand, 37745732 - 37745448
Alignment:
| Q |
7 |
agaatccagcaccaattccatttccagttcca------ccaagatttccagggatagtggggaaagtattaccactggtacagccaccagggaaggtgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745732 |
agaatccagcaccaattccatttccagttccagttccaccaagatttccagggatagtgggaaaagtattaccactggtacagccaccagggaaggtgca |
37745633 |
T |
 |
| Q |
101 |
aaaccttaacccatcaggaccatagtttacacctgcagcaaagttaccagggctactgggaagtatcccatttcctcctcccatattgaaagtttcagga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745632 |
aaaccttaacccatcaggaccatagtttacacctgcagcaaagttaccagggctactgggaagtatcccatttcctcctcccatattgaaagtttcagga |
37745533 |
T |
 |
| Q |
201 |
tgtttcacactctccttcagtaaccttccagctccttccacatgaattgaacaaaatataaccaacacaatgcacaacatcacca |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745532 |
tgtttcacactctccttcagtaaccttccagctccttccacatgatttgaacaaaatataaccaacacaatgcacaacatcacca |
37745448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University