View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5564-Insertion-4 (Length: 215)
Name: NF5564-Insertion-4
Description: NF5564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5564-Insertion-4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 7544783 - 7544578
Alignment:
| Q |
8 |
acaagttcccagcaactcttttcaccaccgtcctccgcggtaaacttcggcaccgacatcgtcaccttccgatcttgcctcgtcttcatatcactcaaat |
107 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| | |
|
|
| T |
7544783 |
acaagttcccagaaactcttttcaccaccgtcctccgcggtaaacttcggcaccgtcatcgccaacttccgatcttgcctcgtcttcatatcactcagtt |
7544684 |
T |
|
| Q |
108 |
ccatttgcaatggaaactttacagtcccaaatataccagaataactcttcctatcactgctacttctctgccaccggctttccctcccggatggcgaccg |
207 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7544683 |
ccatttgcaatggaaacttcaccgtcccaaatataccagtataactcttcctatcactgctacttctctgccaccggttttccctcccggatggcgaccg |
7544584 |
T |
|
| Q |
208 |
gagtcc |
213 |
Q |
| |
|
||||| |
|
|
| T |
7544583 |
cagtcc |
7544578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 10 - 213
Target Start/End: Complemental strand, 7554559 - 7554356
Alignment:
| Q |
10 |
aagttcccagcaactcttttcaccaccgtcctccgcggtaaacttcggcaccgacatcgtcaccttccgatcttgcctcgtcttcatatcactcaaatcc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7554559 |
aagttcccagcaactcttttcaccaccgtcctctgcggtaaacttcggcaccgtcatcgccaacttccgatcttgcctcgtcttcatatcactcagttcc |
7554460 |
T |
|
| Q |
110 |
atttgcaatggaaactttacagtcccaaatataccagaataactcttcctatcactgctacttctctgccaccggctttccctcccggatggcgaccgga |
209 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
7554459 |
atttgcaatggaaacttcaccgtcccaaatataccagtataactcttcctatcactgctacttctctgccaccggttttccctcccggatggcgaccgca |
7554360 |
T |
|
| Q |
210 |
gtcc |
213 |
Q |
| |
|
|||| |
|
|
| T |
7554359 |
gtcc |
7554356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University