View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5564-Insertion-5 (Length: 132)
Name: NF5564-Insertion-5
Description: NF5564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5564-Insertion-5 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 87; Significance: 4e-42; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 87; E-Value: 4e-42
Query Start/End: Original strand, 18 - 132
Target Start/End: Original strand, 7715827 - 7715941
Alignment:
| Q |
18 |
cttttctcttcactacaatgttctattgtagcttcaactgaatttgaagttggtgacttaaaaggttgggttgttccttcttctaatgacaccgatatct |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
7715827 |
cttttctcttcacttcaatgttctattgttgcttcaactgaatttgaagttggtgacctaaaaggttgggttgttccaccctctaacgacaccgatatct |
7715926 |
T |
|
| Q |
118 |
acaatatttgggctt |
132 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7715927 |
acaatatttgggctt |
7715941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University