View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5564_high_3 (Length: 290)
Name: NF5564_high_3
Description: NF5564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5564_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 53175111 - 53175380
Alignment:
| Q |
1 |
acttttattcccaaaaatttcatgaatattatactatgaactttttcnnnnnnnnncaaacaagtcttaatcacctgagttgaagccattggtagcatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175111 |
acttttattcccaaaaatttcatgaatattatactatgaactttttcaaaaaaa--caaacaagtcttaatcacctgagttgaagccattggtagcatca |
53175208 |
T |
|
| Q |
101 |
aacaactcttcataagagaaacatttccaagttggtctttgacaagtttcttcttcatatggaagaatcttcaagctcttttcattttcttcacctttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175209 |
aacaactcttcataagagaaacatttccatgttggtttttgacaagtttcttcttcatatggaagaatcttcaagctcttttcattttcttcacctttgg |
53175308 |
T |
|
| Q |
201 |
gactcagaactggttcccctaaaccacgtttggtaaatgagaagagcctcttgaagctgcctgttcttatat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175309 |
gactcagaactggttcccctaaaccacgtttggtaaatgagaagagcctcttgaagctgcctgttcttatat |
53175380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University