View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5564_high_8 (Length: 213)
Name: NF5564_high_8
Description: NF5564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5564_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 1516253 - 1516445
Alignment:
| Q |
1 |
cttgcaaatagtggaatattaaattatattttttcgattacgtttcctggcaggatttgatgcttggtgttgccgatcttaatacacctgaggctgttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516253 |
cttgcaaatagtggaatattaaattatattttttcgattacgtttcctggcaggatttgatgcttggtgttgccgatcttaatacacctgaggctgttgc |
1516352 |
T |
 |
| Q |
101 |
tgctgcagagtcagctatttccaattctcagcctgtgatttcattggctgctgacgatgatagtgaaacagattcagaagaagaaagtagcac |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1516353 |
tgctgcagagtcagctatttccaattctcagcctgtgatttcattggctgctgacgatgatagtgaaacagattcagaagaagaaagtagcac |
1516445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 47 - 188
Target Start/End: Complemental strand, 36613686 - 36613548
Alignment:
| Q |
47 |
ctggcaggatttgatgcttggtgttgccgatcttaatacacctgaggctgttgctgctgcagagtcagctatttccaattctcagcctgtgatttcattg |
146 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| ||||||| |||||||| || ||||||||||||||| |||||| || ||||||||||||||||||| |
|
|
| T |
36613686 |
ctggcaggatttgatgcttggtgttgctgatcttcatacaccagaggctgtggcagctgcagagtcagctgtttccagttgtcagcctgtgatttcattg |
36613587 |
T |
 |
| Q |
147 |
gctgctgacgatgatagtgaaacagattcagaagaagaaagt |
188 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
36613586 |
gctgct---gatgatagtgaaatagattcagaagaagaaagt |
36613548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University