View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5564_low_5 (Length: 272)
Name: NF5564_low_5
Description: NF5564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5564_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 248
Target Start/End: Original strand, 53174843 - 53175081
Alignment:
| Q |
10 |
cagaacctgtggtggatagttcaaaaacaaagtaaagtccattgtcaatacaacatcctagaagagataaaacattggaatgacgaacatgaccaattgt |
109 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174843 |
cagaaccagtggtggatagttcaaaaacaaagtaaagtccattgtcaatacaacatcctagaagagataaaacattggaatgacgaacatgaccaattgt |
53174942 |
T |
 |
| Q |
110 |
tccaatctctgtcaaaaactctttctcttttctttcatcctttgaagctcttgttaatctcttcacagcaatttcttcaccatttttcaatgttcccttg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53174943 |
tccaatctctgtcaaaaactctttctcttttctttcatcctttgaagctcttgttaatctcttcacagcaatttcttcaccatttttcaatgttcccttg |
53175042 |
T |
 |
| Q |
210 |
taaacctcagcataaccaccttttccaaccatattttct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53175043 |
taaacctcagcataaccaccttttccaaccatattttct |
53175081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University