View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565-Insertion-5 (Length: 289)
Name: NF5565-Insertion-5
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 7 - 254
Target Start/End: Original strand, 32695911 - 32696158
Alignment:
| Q |
7 |
attgtaaggaagaagcagggaaagaatttaaacttgaggatgatattgatgaagttgctgatctttttattagaaggtttaaaaggaatataatcttgca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32695911 |
attgtaaggaagaagcagggaaagaatttaaacttgaggatgatattgatgaagttgctgatctttttattaggaggtttaaaaggaatataatcttgca |
32696010 |
T |
|
| Q |
107 |
gaaacaagattcattgaagaggaagagggaaatggtgcagaagggtacttgaatttcaagtttgatcttgattcaatggctctatattgctgcacaggat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32696011 |
aaaacaagattcattgaagaggaagagggaaatggtccaaaagggtgcttgaatttcaagtttgatcttgattcaatggctctatattgctgcacaggat |
32696110 |
T |
|
| Q |
207 |
ccaaactcgtcctgatacacgaaagctcaacctcatcattctctccct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32696111 |
ccaaactcgtcctgatacacgaaagctcaacctcatcattctctccct |
32696158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 7 - 162
Target Start/End: Original strand, 32686811 - 32686966
Alignment:
| Q |
7 |
attgtaaggaagaagcagggaaagaatttaaacttgaggatgatattgatgaagttgctgatctttttattagaaggtttaaaaggaatataatcttgca |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32686811 |
attgtaaggaagaagcagggaaagaatttaaacttgaggatgatattgatgaagttgctgatctttttattaggaggtttaaaaggaatataatcttgca |
32686910 |
T |
|
| Q |
107 |
gaaacaagattcattgaagaggaagagggaaatggtgcagaagggtacttgaattt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||| ||||||||| |
|
|
| T |
32686911 |
aaaacaagattcattgaagaggaagagggaaatggtccaaaagggtgcttgaattt |
32686966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 12 - 162
Target Start/End: Original strand, 32679826 - 32679976
Alignment:
| Q |
12 |
aaggaagaagcagggaaagaatttaaacttgaggatgatattgatgaagttgctgatctttttattagaaggtttaaaaggaatataatcttgcagaaac |
111 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |||||||| ||||| |||| |
|
|
| T |
32679826 |
aaggaagaagcagggaaagagtttaaacttgaggatgatattgatgaagttgccgatctttttattaggaggtttaaaagaaatataattttgcaaaaac |
32679925 |
T |
|
| Q |
112 |
aagattcattgaagaggaagagggaaatggtgcagaagggtacttgaattt |
162 |
Q |
| |
|
|||||||||||| ||||| |||||||| ||||| |||||||||| ||||| |
|
|
| T |
32679926 |
aagattcattgaggaggaggagggaaaccgtgcaaaagggtacttaaattt |
32679976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University