View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565-Insertion-7 (Length: 83)
Name: NF5565-Insertion-7
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565-Insertion-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 68; Significance: 5e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 68; E-Value: 5e-31
Query Start/End: Original strand, 8 - 83
Target Start/End: Original strand, 39300247 - 39300322
Alignment:
| Q |
8 |
cttgtctaccactgtaagttgttcaaaatgagttgtcatctttgggactctgtctttttcaacatgaatatctctc |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300247 |
cttgtctaccactgtaagttgttcaaaatgggtagtcatctttgggactctgtctttttcaacatgaatatctctc |
39300322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University