View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_high_15 (Length: 433)
Name: NF5565_high_15
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 8e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 8e-99
Query Start/End: Original strand, 208 - 419
Target Start/End: Complemental strand, 3111011 - 3110796
Alignment:
| Q |
208 |
cattttatctttcaaaaccttgttagtatattctgctgagatggaattagtagtggtagtttgttagaagttagttattcctctctcttgc----atatt |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3111011 |
cattttatctttcaaaaccttgttagtatattctgctgagatggaattagtagtggtagtttgttagaagttagttattcctctctcttgcttgcatatt |
3110912 |
T |
 |
| Q |
304 |
gagtggcattaaattggccagtaagcctcagtgaaaagtatcaacattttagctccaacagtattctctcttctacttcctctcaaccactcttcctaat |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
3110911 |
gagtggcattaaattggccagtaagcctcagtgaaaagtatcaacattttagctctaacaatattctctcttctacttcctttcaaccgctcttcctaat |
3110812 |
T |
 |
| Q |
404 |
gcaattgcaacctatg |
419 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3110811 |
gcaattgcaacctatg |
3110796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University