View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_high_20 (Length: 349)
Name: NF5565_high_20
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 34 - 331
Target Start/End: Original strand, 37796700 - 37796997
Alignment:
| Q |
34 |
gaagaggtaaagatgagtgagaggttaataatttgagagataaagacataaagtggaaacaaagagtgtaggagggagagtagaaaatgattaaggtcct |
133 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37796700 |
gaagaggtaaagatgagtgagaggttaacaatttgagagataaagacataaagtggaaacaaagagtgtaggagggagagtagaaaatgattaaggtcct |
37796799 |
T |
 |
| Q |
134 |
tagacaagaaaccctttgttgtgaaaacaaaaagtcgattgcttattgtaccagaagtctgtatggcaaggccaaaaagagggaagtgaatttagtgccg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37796800 |
tagacaagaaaccctttgttgtgaaaacaaaaagtcgattgcttattgtaccagaagtctgtatggcaaggccaaaaagagggaagtggatttagtgccg |
37796899 |
T |
 |
| Q |
234 |
taaaaaacaacacaatttttattttaattattcgatgagtttgacaaagttacaataataccgtctaataaagagatatttatatttccactgatgca |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37796900 |
taaaaaacaacacaatttttattttaattattcgatgagtttgacaaagttacaataataccgtctaataaagagatatttatatttccactgatgca |
37796997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University