View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_high_46 (Length: 238)
Name: NF5565_high_46
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 16807201 - 16807030
Alignment:
| Q |
18 |
atgaacgataagttgaagtgcttcgtctatgaaaacaactataagttcaaagaagagttagtactcaagaagcccaattacatgaatgaactacgaggag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
16807201 |
atgaacgataagttgaagtgcttcgtctatgaaaacaactataagttcaaagaagagttaggactcaacaagatcaattacatgaatgaactacgaggag |
16807102 |
T |
 |
| Q |
118 |
aagcggttggaagctgaagccgtgaagaataaacaaccttagaaattaagcgataacaaacgcagtgatgac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16807101 |
aagcggttggaagctgaagccgtgaagaataaacaaccttagaaattaagcgataacaaatgcagtgatgac |
16807030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University