View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_high_51 (Length: 226)
Name: NF5565_high_51
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_high_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 18867415 - 18867205
Alignment:
| Q |
1 |
aaaagtgcttgagtatgactctcaatcaattgcaaagcttctttatatctcaatttacaaccatccaacactaatctaggtcgcttaaagccctttacat |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18867415 |
aaaagggcttgagtatgactctctatcagttgcaaagcttctttatatctcaatttacaaccatccaacactaatctaggtcgcttaaagccctttacat |
18867316 |
T |
|
| Q |
101 |
aatctttcaaagttccattttcaatttcttgcttaccaaggaacacatttttcgatccatgtccagtatgatgatcatggtcagacaaagattggcgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
18867315 |
aatctttcaaagttccattttcaatttcttgcttaccaaggaacacgtttttcgatccatgtccagtattaagatcatggtcagacaaaaattggcgttt |
18867216 |
T |
|
| Q |
201 |
ttcttgttcat |
211 |
Q |
| |
|
|||| |||||| |
|
|
| T |
18867215 |
ttctagttcat |
18867205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 136
Target Start/End: Complemental strand, 18881383 - 18881333
Alignment:
| Q |
86 |
taaagccctttacataatctttcaaagttccattttcaatttcttgcttac |
136 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
18881383 |
taaagccctttatataatctttcaaatctccaatttcattttcttgcttac |
18881333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 136
Target Start/End: Complemental strand, 18888029 - 18887979
Alignment:
| Q |
86 |
taaagccctttacataatctttcaaagttccattttcaatttcttgcttac |
136 |
Q |
| |
|
|||||||||||| ||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
18888029 |
taaagccctttatataatctttcaaatctccaatttcattttcttgcttac |
18887979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University