View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_low_22 (Length: 329)
Name: NF5565_low_22
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 13 - 310
Target Start/End: Original strand, 6010055 - 6010352
Alignment:
| Q |
13 |
caaaggaaaagaacgtgaaaatggagagtatttggatgtatgtggagtcaaagacaagtcaaagttggtgttgattcaagatgcttcaagtattgagaga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010055 |
caaaggaaaagaacgtgaaaatggagagtttttggatgtatgtggagtcaaagacaagtcaaagttggtgttgattcaagatgcttcaagtattgagaga |
6010154 |
T |
 |
| Q |
113 |
aggttcatccagatgcgtatcaatgctaagatccaaactgcaaatcgtgccatcaataatgtgtctctccaacttgatcagctagcagaacaagtatctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010155 |
aggttcatccagatgcgtatcaatgctaagatccaaactgcaaatcgtgccataaataatgtgtctctccaacttgatcagctagcagaacaagtatctg |
6010254 |
T |
 |
| Q |
213 |
caattgaaaaatcaatttctgatggagttaaagtaccagaagttcagatcgtaacacttattgagatgcttatgaaacaagccatcagattagaaagc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6010255 |
caattgaaaaatcaatttctgatggagttaaagtaccagaagttcagatcataacacttattgagatgcttatgaaacaagccatcagattagaaagc |
6010352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University