View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_low_26 (Length: 309)
Name: NF5565_low_26
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 132 - 296
Target Start/End: Original strand, 3111010 - 3111173
Alignment:
| Q |
132 |
tggttaattgagtctgccacaacatgatgaaataaacatggactaacaatgtgatactttggtttttgatcacttaaaaggaagagaagttggtagttgt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3111010 |
tggttaattgagtctgccacaacatgatgaaataaacatggactaacaatgtgatactttggtttttgatcacttaaa-ggaagagaagttggtagttgt |
3111108 |
T |
|
| Q |
232 |
tggaggtggagcagcaggggtgtatggagcaattcatgccaaaactattgcacctcacctaaatg |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3111109 |
tggaggtggagcagcaggggtgtatggagcaattcatgccaaaactattgcacctcacctaaatg |
3111173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 80 - 171
Target Start/End: Original strand, 3103139 - 3103230
Alignment:
| Q |
80 |
ttcatgctgccacgtataagtttaatttaatttcatattgcaaactttagattggttaattgagtctgccacaacatgatgaaataaacatg |
171 |
Q |
| |
|
|||||||| ||||| | |||| |||| |||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
3103139 |
ttcatgctttcacgttttagttaaattaaatttcatattgcaaactttagtttggttaattgagtctgccatgacatggtgaaataaacatg |
3103230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University