View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_low_31 (Length: 285)
Name: NF5565_low_31
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 275
Target Start/End: Original strand, 36457247 - 36457503
Alignment:
| Q |
19 |
gtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagaatctacgcagagattcagctgcaaaagctgatgtagaatgctgtcagatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457247 |
gtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagagtctacacagagattcagctgcaaaagctgatgtagaatgctgtcagatt |
36457346 |
T |
 |
| Q |
119 |
tatatgcaggcgacgagtttagagcagcatatcacctaatttggcgatgtgtcgaaagtccaggttttcgggtggaagctcctgcagaagaggctgcagt |
218 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36457347 |
tatatgcaggcgacgagtttaaagtagcatatcacctaatttggcgatgtgtcgaaagtccaggttttcgtgtggaagctcctgcagaagaggctgcagt |
36457446 |
T |
 |
| Q |
219 |
caatgttgaatttaatcacaagaaacattatgcctgcggatcataattcatcctttg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457447 |
caatgttgaatttaatcacaagaaacattatgcctgcggatcataattcatcctttg |
36457503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University