View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_low_32 (Length: 274)
Name: NF5565_low_32
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 17 - 242
Target Start/End: Complemental strand, 39692626 - 39692397
Alignment:
| Q |
17 |
aaatgcaaatcatatggtaaaataggacatttggtacgctggaatacaagtttgaacatacaaattatccgggttttgtgt----aagtttcgcggttat |
112 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| |||||||||| ||||||||||||||||||||| |||| |||||||| ||||||||| ||||| |
|
|
| T |
39692626 |
aaatgcaaatcatatgggaaaatcggacatttgctacgctggaacacaagtttgaacatacaaattctccgttttttgtgtgtgcaagtttcgctgttat |
39692527 |
T |
|
| Q |
113 |
actctttaaaacaaaaaagaaagtgaatttttcgagatgatgaaattaattagaattataaattttgatatgtttgaaannnnnnnatttgaattgattc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
39692526 |
actctttaaaacaaaaaagaaagtgaatttttcgagatgatgaaattaattagaattataaattttgatatgtttgaaaaaattttacttgaattgatta |
39692427 |
T |
|
| Q |
213 |
taacaaaatcaaaatttagagcttttattt |
242 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
39692426 |
taacaaaatcaaaatttagagctttaattt |
39692397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 75
Target Start/End: Original strand, 39930694 - 39930752
Alignment:
| Q |
17 |
aaatgcaaatcatatggtaaaataggacatttggtacgctggaatacaagtttgaacat |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||||| | |||| || |||||| |
|
|
| T |
39930694 |
aaatgcaaatcatatggtaaaataggacattcggtatgctgggacacaaattcgaacat |
39930752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University