View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_low_42 (Length: 242)
Name: NF5565_low_42
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 35611564 - 35611339
Alignment:
| Q |
1 |
ctcaccatcttttcttccggtcccagtttgctacagagttgtggttgtggcttggctcctgcctcgctgatcttcgcagattacatatatgtttgtcgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
35611564 |
ctcaccatcttttcttccggtcccagtttgctacagagttgtggttgtggcttggctcctgcctcactgatcttcgcagattacagatatgtttgtcgta |
35611465 |
T |
 |
| Q |
101 |
gcaattgttcatacttaacatgctatttggatgtcccgtaacaacttatgtttcaagaatatcaaagcaagtattcatgcgaccaaggtaaagattcatt |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
35611464 |
gcaattgttcatactttacatgctatttggatgtcccgtaacaacttatgtttcaagaatatcaaagcaagtattcatgcggccaaggtaaagattgatt |
35611365 |
T |
 |
| Q |
201 |
attcggttactatgagtggtaatact |
226 |
Q |
| |
|
|||||||||| ||||||||||||||| |
|
|
| T |
35611364 |
attcggttacgatgagtggtaatact |
35611339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University