View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5565_low_48 (Length: 238)

Name: NF5565_low_48
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5565_low_48
NF5565_low_48
[»] chr8 (1 HSPs)
chr8 (18-189)||(16807030-16807201)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 16807201 - 16807030
Alignment:
18 atgaacgataagttgaagtgcttcgtctatgaaaacaactataagttcaaagaagagttagtactcaagaagcccaattacatgaatgaactacgaggag 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||  ||||||||||||||||||||||||||    
16807201 atgaacgataagttgaagtgcttcgtctatgaaaacaactataagttcaaagaagagttaggactcaacaagatcaattacatgaatgaactacgaggag 16807102  T
118 aagcggttggaagctgaagccgtgaagaataaacaaccttagaaattaagcgataacaaacgcagtgatgac 189  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
16807101 aagcggttggaagctgaagccgtgaagaataaacaaccttagaaattaagcgataacaaatgcagtgatgac 16807030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University