View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5565_low_55 (Length: 220)
Name: NF5565_low_55
Description: NF5565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5565_low_55 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 36 - 203
Target Start/End: Original strand, 18868069 - 18868238
Alignment:
| Q |
36 |
tgagatgtcacactgctgcatccataatgttggattcgaactcagtct----ctggttaagccggaagaaatctcttttgcatttgttttatggaagctt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| || |||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18868069 |
tgagatgtcacactgctgcatccataatattggactcaaactcagtctgtctctggttaagctgaaagaaatctcttttgcatttgttttatggaagctt |
18868168 |
T |
|
| Q |
132 |
atgtacatttgattaaaatcaattaattatcatttttatagaacaaatagctatttgtgactttgtatttta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
18868169 |
atgtacatttgattaaaatcaattaattatcatttttat--aacaaatagctatttgtgactttgtctttta |
18868238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University