View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5566-Insertion-3 (Length: 185)
Name: NF5566-Insertion-3
Description: NF5566
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5566-Insertion-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 2e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 7 - 170
Target Start/End: Complemental strand, 32504553 - 32504391
Alignment:
| Q |
7 |
agtaacaatctgacggggttaacacaatgcacattcctcaacatggatcccaaaaacacacactaacttgatcttgtaatgttaacacaatgcaagacca |
106 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32504553 |
agtaacaatctgacggg-ttaacacaatgcacattcctcaacatggatcccaaaaacacacaccaacttgatcttgtaatgttaacacaatgcaagacca |
32504455 |
T |
|
| Q |
107 |
ttttttatggtaaaacttcattgtaatatggtactagtttttaagtcccacatcggcacatcca |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32504454 |
ttttttatggtaaaacttcattgtaatatggtagtagtttttaagtcccacatcggcacatcca |
32504391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 114 - 160
Target Start/End: Complemental strand, 32500547 - 32500501
Alignment:
| Q |
114 |
tggtaaaacttcattgtaatatggtactagtttttaagtcccacatc |
160 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
32500547 |
tggtaaaacttcattgtaatatgatagtagtttttaagtcccacatc |
32500501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University