View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5567_high_16 (Length: 223)
Name: NF5567_high_16
Description: NF5567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5567_high_16 |
 |  |
|
| [»] scaffold0152 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0152 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: scaffold0152
Description:
Target: scaffold0152; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 32 - 195
Target Start/End: Complemental strand, 13129 - 12966
Alignment:
| Q |
32 |
tgacaatctaggtatgtaaaccttctctccaatgttgtcaccggttatgcaaccacgtaaaaaccgcatattagttgtaagtgtcaaaacttcacaatga |
131 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||| | |
|
|
| T |
13129 |
tgacaatctatgtatgtaaaccttctctccaatgttgtcaccggttatgcagccacgtaaaagccgcatattagttgcaagtgtcaaaacttcacaataa |
13030 |
T |
 |
| Q |
132 |
ttccacaacgatgaagaatttattggtgcaagaactatttcttgccttgttccttttgggataa |
195 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13029 |
ttccacaacgatgaagaattcattggtgcaagaactatttcttgccttgttccttttgggataa |
12966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University