View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5568_high_9 (Length: 221)
Name: NF5568_high_9
Description: NF5568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5568_high_9 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 22 - 221
Target Start/End: Complemental strand, 40444948 - 40444749
Alignment:
| Q |
22 |
ccagaaattgatttggattcatacttttcagaacaaaacagttttcttgaaatccttggttttgaagctgatacaaaattgattgacttcacttcttctc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40444948 |
ccagaaattgatttggattcatacttttcagaacataacagttttcttgaaatccttggttttgaagctgatacaaaattgattgacttcacttcttctc |
40444849 |
T |
 |
| Q |
122 |
ataataaggtacaaaacttgcatgaagaaagtcccttagaggaaactcaaaagacgtccaatttggcagaatcaatggtgttggagaggaaggaacaaag |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40444848 |
ataataaggtacaaaacttgcatgaagaaagtcccttagaggaaactcaaaagacgaccaatttggcagaatcaatggtgttagagaggaaggaacaaag |
40444749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University