View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5568_low_6 (Length: 260)
Name: NF5568_low_6
Description: NF5568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5568_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 12 - 244
Target Start/End: Complemental strand, 2660158 - 2659911
Alignment:
| Q |
12 |
atatgtatccacgagtacctagaagtatcatatatgtatctagtaaattattttttacaaagtaaaataaataattacgttacttacgatacttctaagg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2660158 |
atatgtatccacgagtacctagaagtatcatatatgtatctagtaaattattttttacaaaataaaataaataattacgttacttacgatacttctaagg |
2660059 |
T |
 |
| Q |
112 |
aacgcacgagtatcattatttgaaatagatccgtcttcaattttgaagtatccgagtttcatagtctaacgaaaa---------------cgagaaaatt |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||||||| |
|
|
| T |
2660058 |
aacgcacgagtatcattatttgaaacagatccgtcttcaattttgaagtatccgaatttcatagtctaacggaaaaattagatcaactctagagaaaatt |
2659959 |
T |
 |
| Q |
197 |
ccaagagattaagcagcttgacaaatataaagggtataattctctgct |
244 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2659958 |
ccaagagattaagcagcttgacagatataaagggtataattctctgct |
2659911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University