View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569-Insertion-11 (Length: 335)
Name: NF5569-Insertion-11
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569-Insertion-11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 11 - 335
Target Start/End: Original strand, 32763458 - 32763782
Alignment:
| Q |
11 |
ttgttctagatagatttggctaatacattattgtccttgaaagaaggaagtggtcacattagcctatctattctttaaaatttcagtactcatagcttat |
110 |
Q |
| |
|
||||||||| | ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32763458 |
ttgttctagttggattttgctaatacattattgtccttgaaagaaggaagtggtcacattagcctatctattctttaaaatttcagtactcatagcttat |
32763557 |
T |
 |
| Q |
111 |
gaagattgatcttgtttccatatctcattgcgaacaatcacaatcccatgacctttatgccttgtactctaaaccttatcttattgccatcaatatgtca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32763558 |
gaagattgatcttgtttccatatctcattgcgaacaatcacaatcccatgacctttatgccttgtactctaaaccttatcttatttccatcaatatgtca |
32763657 |
T |
 |
| Q |
211 |
tcataactactattttagctaatcactacagttgaaaaaagtggtaatcaatataaagtctcatttgaaatgatgttaatatcacgcgatacaactctgc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32763658 |
tcataactactattttagctaatcactacagttgaaaaaagtggtaatcaatataaagtctcatttgaaatgatgttaatatcacgcgatacaactctgc |
32763757 |
T |
 |
| Q |
311 |
gctagcggtagccatcatattttac |
335 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32763758 |
gctagcggtagccatcatattttac |
32763782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University