View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569-Insertion-13 (Length: 284)
Name: NF5569-Insertion-13
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569-Insertion-13 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 8 - 284
Target Start/End: Complemental strand, 32220396 - 32220120
Alignment:
| Q |
8 |
gataagatatacaacaatcaatacttaaagggatggcaaattcaatgtccttattaattaatcaagatgctatttcatttgaataagcctccaacagtct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32220396 |
gataagatatacaacaatcaatacttaaagggatggcaaattcaatgtccttattaattaatcaagatgctatttcatttgaataagcctccaacagtct |
32220297 |
T |
|
| Q |
108 |
ttttaacaccatcaagcacacctgcttcttcggttttggcaggctccgcaggtttggaatgaacataatcagcagccctatcaatttgctctacaactgt |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32220296 |
ttttaacaccatcaagcacaccagcttcttcggttttggcaggctccacaggtttagaatgaacataatcagcagccctatcaatttgctctacaactgt |
32220197 |
T |
|
| Q |
208 |
cttcttaacaccctctgcagcagttgctaccttttcaccttgtttcaccaccgttgtctgtgctgattctgctgcca |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32220196 |
cttcttaacaccctctgcagcagttgctaccttttcaccttgtttcaccacagttgtctgtgctgattctgctgcca |
32220120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 80 - 284
Target Start/End: Complemental strand, 32218683 - 32218479
Alignment:
| Q |
80 |
tttcatttgaataagcctccaacagtctttttaacaccatcaagcacacctgcttcttcggttttggcaggctccgcaggtttggaatgaacataatcag |
179 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||| | ||||||| | ||| |||||||||||| ||||| |
|
|
| T |
32218683 |
tttcatttgaataagcctccaacagcttttttaacaccatcaagcacaccaccttcttcggatttaggaggctcctctggtgtggaatgaacatgatcag |
32218584 |
T |
|
| Q |
180 |
cagccctatcaatttgctctacaactgtcttcttaacaccctctgcagcagttgctaccttttcaccttgtttcaccaccgttgtctgtgctgattctgc |
279 |
Q |
| |
|
||||||| |||| ||||| || || ||||||||| | ||||||||||||||| ||||| ||| ||||| | |||| |||||||||||||||||||| |
|
|
| T |
32218583 |
cagccctgtcaacgtgctcaactacggtcttcttagccttctctgcagcagttgccaccttctcagattgttgccccacagttgtctgtgctgattctgc |
32218484 |
T |
|
| Q |
280 |
tgcca |
284 |
Q |
| |
|
||||| |
|
|
| T |
32218483 |
tgcca |
32218479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University