View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569_high_20 (Length: 292)
Name: NF5569_high_20
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569_high_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 35 - 270
Target Start/End: Complemental strand, 22203529 - 22203294
Alignment:
| Q |
35 |
agagtttgttttttgtcctctatatctagataccgtccatggtgaaaactggcatcaagtactgagtacgatggcatcttgtgaaatcatggttagtagt |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22203529 |
agagtttgttttttgtcctctatatctagataccgtccatggtgaaaactggcatcaagtactgagtacgatggcatcttgtgaaatcatggttagtagt |
22203430 |
T |
 |
| Q |
135 |
aagtactagtgtgccaggttatgtcagcaccacgtgttgtggccatagtagtactattaaaacttgacatcattttataccagaaaaacaaaaagattct |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22203429 |
aagtactagtgtgccaggttatgtcagcaccacgtgttgtggccatagtagtactattaaaacttgacatcattttctaccagaaaaacaaaaagattct |
22203330 |
T |
 |
| Q |
235 |
atctcaaccttatgcagcttgcaatttgaacttgtt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22203329 |
atctcaaccttatgcagcttgcaatttgaacttgtt |
22203294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University