View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5569_high_21 (Length: 289)

Name: NF5569_high_21
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5569_high_21
NF5569_high_21
[»] chr4 (2 HSPs)
chr4 (120-272)||(45465449-45465601)
chr4 (17-54)||(45465655-45465693)


Alignment Details
Target: chr4 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 120 - 272
Target Start/End: Complemental strand, 45465601 - 45465449
Alignment:
120 aagatagattgttaattgaatgaatgattgattcggtgattgaagcggtgaggaagaagaggagtatttgttaatggagaagatgagtccagatgtttct 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45465601 aagatagattgttaattgaatgaatgattgattcggtgattgaagcggtgaggaagaagaggagtatttgttaatggagaagatgagtccagatgtttct 45465502  T
220 ggggggaagagaaaaagaaactactagaatactctcttatattcgagtctttt 272  Q
    | |||||||||||||||||||||||||||| ||||||| ||||||||||||||    
45465501 gtggggaagagaaaaagaaactactagaattctctcttctattcgagtctttt 45465449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 45465693 - 45465655
Alignment:
17 ttctggattcattgtgaacgatga-ttgttgatggaatg 54  Q
    |||||||||||||||||||||||| ||||||||||||||    
45465693 ttctggattcattgtgaacgatgatttgttgatggaatg 45465655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University