View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569_high_29 (Length: 239)
Name: NF5569_high_29
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569_high_29 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 45103028 - 45103252
Alignment:
| Q |
18 |
acaaacatgattttcttcattttcacttctctttttcttatactaaatgatacaaaa---agaagaaaaaacactttatttctttgttctttctcgcttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
45103028 |
acaaacatgattttcttcattttcacttctctttttcttatactaaatgatacaaaagagaaaaaaaaaaacaatttatttctttgttctttctcgcttg |
45103127 |
T |
 |
| Q |
115 |
tttctttcttatgaacatattcttttccatagcctaacaaaattttagaagtctctacatctacatgatggtatgcatgatgccattgattcctaccaat |
214 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45103128 |
tttctttcttctaaacatattcttttccattgcctaacaaaattctagaagtctctacatctacatgatggtatgcatgatgccattgattcctaccaat |
45103227 |
T |
 |
| Q |
215 |
accatgtctcatctcaatcggacct |
239 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45103228 |
accatgtctcatctcaatcggacct |
45103252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University