View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569_high_31 (Length: 238)
Name: NF5569_high_31
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569_high_31 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 7 - 232
Target Start/End: Complemental strand, 26258438 - 26258213
Alignment:
| Q |
7 |
gttccgatacggttgtaacatgatttaagatcacattgcaattgtggtgccaaccacatcaacaatatattgcagccgcaattgcggatgtggactacaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258438 |
gttccgatacggttgtaacatgatttaagatcacattgcaattgtggtgccaaccacatcaacaatatattgcagccgcaattgcggatgtggactacaa |
26258339 |
T |
 |
| Q |
107 |
tttgaaatcatgatccaaccgtcagtataaaaatttctacaccaattgtcataccaataaaagcttttgaatttaattgtaacacatctaaagttacact |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26258338 |
tttgaaatcatgatccaaccgtcagtataaaaatttctacaccaattgtcataccaataaaagcttttgaatttaattgtaacacatctaaagttacact |
26258239 |
T |
 |
| Q |
207 |
cattagttgctatttgttgatgatgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
26258238 |
cattagttgctatttgttgatgatgt |
26258213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 73 - 118
Target Start/End: Original strand, 39462492 - 39462537
Alignment:
| Q |
73 |
atattgcagccgcaattgcggatgtggactacaatttgaaatcatg |
118 |
Q |
| |
|
||||||| || ||||||||||||||||||| |||||||||| |||| |
|
|
| T |
39462492 |
atattgctgctgcaattgcggatgtggactgcaatttgaaaccatg |
39462537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University