View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569_low_18 (Length: 359)
Name: NF5569_low_18
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-100
Query Start/End: Original strand, 6 - 219
Target Start/End: Original strand, 26216974 - 26217187
Alignment:
| Q |
6 |
agagaagaagatggcacaatatgtagaacgtgggacggaatgacttccatggcttgtgattattttttagaacttttttaaaagcagaatagctccagtg |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
26216974 |
agagatgaagatggcacaatatgtagaacgcgggacggaatgacttccatggcttgtgattattttttagaacttttttagaagcagaatagcaccagtg |
26217073 |
T |
 |
| Q |
106 |
aggcgattcttaatgccattaatccatctatcactattcactagtatggataatgagtttctatttgctgctttcctatttgaagaattcaaggaaacca |
205 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26217074 |
aggcgattcttaataccattaatccatctaacactattcactagtatggataatgagtttctatttgccgctttcctatttgaagaattcaaggaaacca |
26217173 |
T |
 |
| Q |
206 |
tcttctctatgaaa |
219 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
26217174 |
tcttctctatgaaa |
26217187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 216 - 359
Target Start/End: Original strand, 26217246 - 26217389
Alignment:
| Q |
216 |
gaaaaattgtggtcatgatatatttactgcgggttgcactttgaaggtctctgttatctttcctcctagcctaattacaagctcaacaaacattgatcta |
315 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26217246 |
gaaaaattgtggtcatcatatatttactgcgggttgcactttgaaggtctctgttatctttcctcctagcctaattacaaactcaacaaacattgatcta |
26217345 |
T |
 |
| Q |
316 |
atccctataggagaggtttatccatctatagctttatgtaatgt |
359 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26217346 |
atccctataggagaggtttattcatctatagctttatgtaatgt |
26217389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University