View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569_low_22 (Length: 289)
Name: NF5569_low_22
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 120 - 272
Target Start/End: Complemental strand, 45465601 - 45465449
Alignment:
| Q |
120 |
aagatagattgttaattgaatgaatgattgattcggtgattgaagcggtgaggaagaagaggagtatttgttaatggagaagatgagtccagatgtttct |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45465601 |
aagatagattgttaattgaatgaatgattgattcggtgattgaagcggtgaggaagaagaggagtatttgttaatggagaagatgagtccagatgtttct |
45465502 |
T |
|
| Q |
220 |
ggggggaagagaaaaagaaactactagaatactctcttatattcgagtctttt |
272 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
45465501 |
gtggggaagagaaaaagaaactactagaattctctcttctattcgagtctttt |
45465449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 54
Target Start/End: Complemental strand, 45465693 - 45465655
Alignment:
| Q |
17 |
ttctggattcattgtgaacgatga-ttgttgatggaatg |
54 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45465693 |
ttctggattcattgtgaacgatgatttgttgatggaatg |
45465655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University