View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569_low_28 (Length: 243)
Name: NF5569_low_28
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 42494821 - 42495056
Alignment:
| Q |
1 |
tgaacctggatcgctgttgttgttgtcggagtattggttgagtagatccattgttgttgtgaatgttaattgaaagaagatgaagctttttaaattgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42494821 |
tgaacctggatcgctgttgttgttgtcggagtattggttgagtagatccattgttgttgtgaatgttaattgaaagaagatgaagcttttaaaattgctg |
42494920 |
T |
 |
| Q |
101 |
caagaaggtttaaacaatcacttgacaaagatttttcagaagaagaagaaaacaacaagtggagagaaaaaccaacgccttatacagtattatcaataat |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42494921 |
caagaaggtttaaacaatcacttgacagagattttttagaagaagaagaaaacaacaagtggagagaaaaaccaatgccttatacagtattatcaataat |
42495020 |
T |
 |
| Q |
201 |
taaaggtgagagacaaaggaccaaatagtattatct |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42495021 |
taaaggtgagagacaaaggaccaaatagtattatct |
42495056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 32289886 - 32289845
Alignment:
| Q |
16 |
gttgttgttgtcggagtattggttgagtagatccattgttgt |
57 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32289886 |
gttgttgttgtcggtgtattggttgagtagatccattgttgt |
32289845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University