View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569_low_29 (Length: 241)
Name: NF5569_low_29
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569_low_29 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 97 - 241
Target Start/End: Complemental strand, 26217609 - 26217452
Alignment:
| Q |
97 |
aatccagcctatcataggatttactaatataaagtctatgagctacattaccttgattaactttcacct-------------atgaacaatttcaatggt |
183 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26217609 |
aatccaacctatcataggatttactaatataaagtctatgagctacattaccttgattaactttcaccttaggtttcacacgatgaacaatttcaatggt |
26217510 |
T |
 |
| Q |
184 |
tgtcattgcattatcgagaatagagtaacttgacacaaaagctgattgatttttgtat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26217509 |
tgtcattgcattatcgagaatagagtaacttgacacaaaagctgattgatttttgtat |
26217452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University