View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5569_low_37 (Length: 202)
Name: NF5569_low_37
Description: NF5569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5569_low_37 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 202
Target Start/End: Original strand, 42677019 - 42677213
Alignment:
| Q |
8 |
aagaatatcaaagcgaatatgttttagtgtaatcagatctctttcgtgtggtataaagccattgccatttaattttttccatttgagcatggtgctgatt |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
42677019 |
aagaaaatcaaagcgaatatgttttagtgtaatcagatctctttcgtgtggtataaagccattgccatttaattctatccatttgagcatggtgctgatt |
42677118 |
T |
 |
| Q |
108 |
ttttgtcgttggaagctggtcctagccgcaaaccattggagaatacttcccatgttttgtatattgggttgattccacatggcttcaatgagatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||| |
|
|
| T |
42677119 |
ttttgtcgttggaagctggtcctagtcgcaaaccattggagaatacttcccatgttttgtatattggtttgattccacatggcttctaagagatg |
42677213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 137 - 200
Target Start/End: Complemental strand, 48969784 - 48969721
Alignment:
| Q |
137 |
aaaccattggagaatacttcccatgttttgtatattgggttgattccacatggcttcaatgaga |
200 |
Q |
| |
|
|||| |||||||||| |||||| ||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
48969784 |
aaacaattggagaattcttcccctgttttgtatattggtcggattccacatggcttctatgaga |
48969721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University