View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5570-Insertion-11 (Length: 135)
Name: NF5570-Insertion-11
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5570-Insertion-11 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 1e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 8 - 135
Target Start/End: Complemental strand, 1182669 - 1182542
Alignment:
| Q |
8 |
ggaaccacaactgaacaaagtgaaacggattactaagagcatgttttgtttttcttgggtagttgggaggaagcattcaagcgtgttgaaattagggttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1182669 |
ggaaccacaactgaacaaagtgaaacggattactaagagcatgttttgtttttcttgggtagttgggaggaagcattcaagcgtgttgaaattagggttt |
1182570 |
T |
|
| Q |
108 |
gtgaggatatcggagagattgctggtgg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1182569 |
gtgaggatatcggagagattgctggtgg |
1182542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University