View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5570-Insertion-12 (Length: 73)
Name: NF5570-Insertion-12
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5570-Insertion-12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 45; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 6299220 - 6299176
Alignment:
| Q |
10 |
aacatcggacacttccagttccaagtatgttagatagttgatgtt |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6299220 |
aacatcggacacttccagttccaagtatgttagatagttgatgtt |
6299176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University