View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5570_high_12 (Length: 322)

Name: NF5570_high_12
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5570_high_12
NF5570_high_12
[»] chr7 (1 HSPs)
chr7 (11-134)||(37430096-37430219)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 11 - 134
Target Start/End: Original strand, 37430096 - 37430219
Alignment:
11 cagagatgaagaaacggctcagttgcagttatacgaccggatatagggagcccttcagcaggattttgtttcatccactaccataatatatgatcattca 110  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
37430096 cagagatgaagaaacggctcggttgcagttatacgaccggatatagggagcccttcagcgggattttgtttcatccactaccataatatatgatcattca 37430195  T
111 aatcacccacttacttaaaacata 134  Q
    ||||| ||||||||||||||||||    
37430196 aatcaaccacttacttaaaacata 37430219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University