View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5570_high_14 (Length: 270)
Name: NF5570_high_14
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5570_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 2 - 257
Target Start/End: Complemental strand, 14225458 - 14225203
Alignment:
| Q |
2 |
atctaatccttcacctttgcttggaccatctttactctcccatccttcaccatttcctgaaccatctttgttatcccatccttcaactttgcctggaatg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14225458 |
atctaatccttcacctttgcttggaccatctttactctcccatccttcaccatttcctgaaccatctttgttatcccatccttcaactttgcatggaatg |
14225359 |
T |
|
| Q |
102 |
tcgtttttatcctatccttcatcttttctatctcatcgttcaccttttccatctcgatgtacaccttgttctcgttgcgctgaacaatcctatgaaaaat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14225358 |
tcgtttttatcctatccttcatcttttctatctcatcgttcaccttttccatctcgatgtacaccttgttctcgttgcgctgaacaatcctatgaaaaat |
14225259 |
T |
|
| Q |
202 |
cctatcttcaagttcttgcatccagcttggagcttgaccagacaaccctgcatcct |
257 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14225258 |
cctatcttcaagtccttgcatccagcttggagcttgaccagacaaccctgcatcct |
14225203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University