View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5570_high_18 (Length: 251)
Name: NF5570_high_18
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5570_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 52688440 - 52688198
Alignment:
| Q |
1 |
tgtttgttaacatgcaccaagtttctcacctttgtgttgcgggtaacgtcccaatacgatcaaaatatcattcaaagatgaatactgacgtgtgatatcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
52688440 |
tgtttgttaacatgcaccaagtttctcacctttgtgttgcgggtaacgtcccaatacgatcaaaatatcattcaaaggtgaatattgacgtgtgatatcc |
52688341 |
T |
 |
| Q |
101 |
ccaatgggagtctcaatattcctctagtgccatataaaatggcagttattcatccataatggcaaccactaagtggcatcatcataaccaaataattaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52688340 |
ccaatgggagtctcaatattcctctagtgccatataaaatggcagttattcatccataatggcaaccactaagtggcatcatcataaccaaataattaca |
52688241 |
T |
 |
| Q |
201 |
cacatttaaaatgacttaagttttaaattcgataacctttgct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52688240 |
cacatttaaaatgacttaagttttaaattcgctaacctttgct |
52688198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University