View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5570_low_13 (Length: 322)
Name: NF5570_low_13
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5570_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 11 - 134
Target Start/End: Original strand, 37430096 - 37430219
Alignment:
| Q |
11 |
cagagatgaagaaacggctcagttgcagttatacgaccggatatagggagcccttcagcaggattttgtttcatccactaccataatatatgatcattca |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37430096 |
cagagatgaagaaacggctcggttgcagttatacgaccggatatagggagcccttcagcgggattttgtttcatccactaccataatatatgatcattca |
37430195 |
T |
 |
| Q |
111 |
aatcacccacttacttaaaacata |
134 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
37430196 |
aatcaaccacttacttaaaacata |
37430219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University