View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5570_low_15 (Length: 270)

Name: NF5570_low_15
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5570_low_15
NF5570_low_15
[»] chr8 (1 HSPs)
chr8 (2-257)||(14225203-14225458)


Alignment Details
Target: chr8 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 2 - 257
Target Start/End: Complemental strand, 14225458 - 14225203
Alignment:
2 atctaatccttcacctttgcttggaccatctttactctcccatccttcaccatttcctgaaccatctttgttatcccatccttcaactttgcctggaatg 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
14225458 atctaatccttcacctttgcttggaccatctttactctcccatccttcaccatttcctgaaccatctttgttatcccatccttcaactttgcatggaatg 14225359  T
102 tcgtttttatcctatccttcatcttttctatctcatcgttcaccttttccatctcgatgtacaccttgttctcgttgcgctgaacaatcctatgaaaaat 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14225358 tcgtttttatcctatccttcatcttttctatctcatcgttcaccttttccatctcgatgtacaccttgttctcgttgcgctgaacaatcctatgaaaaat 14225259  T
202 cctatcttcaagttcttgcatccagcttggagcttgaccagacaaccctgcatcct 257  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
14225258 cctatcttcaagtccttgcatccagcttggagcttgaccagacaaccctgcatcct 14225203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University