View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5570_low_16 (Length: 251)
Name: NF5570_low_16
Description: NF5570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5570_low_16 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 251
Target Start/End: Complemental strand, 7785927 - 7785694
Alignment:
| Q |
19 |
aagatgctcaaaactcggcttcatgtggttcatcagaagaatcagtatctgcattcagaggttgcaaattcaacactggccttgccatcatctggtagct |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7785927 |
aagatgctcaaaactcgg-ttcatgtggttcatcagaagaatcagtatctgcattcagaggttgcaaattcaacactggccttgccatcatctggtagct |
7785829 |
T |
 |
| Q |
119 |
acagttgttgtcatgtcataagaaataggagcatttgtacttggttattggattattgg--atgtgtaattggtttatttgctccaatctcctctttcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7785828 |
acagttgttgtcatgtcataagaaataggagcatttgtacttagttattggattattggatatgtgtaattggtttatttactccaatctcctctttcac |
7785729 |
T |
 |
| Q |
217 |
ttgtatggattattatgaaaagtttttcttctatt |
251 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
7785728 |
ttgtatggattattatcaaaagtttttcttctatt |
7785694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University